|
Bio-Rad
hard shell plates Hard Shell Plates, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hard shell plates/product/Bio-Rad Average 96 stars, based on 1 article reviews
hard shell plates - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Bio-Rad
white hard shell 96 White Hard Shell 96, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/white hard shell 96/product/Bio-Rad Average 96 stars, based on 1 article reviews
white hard shell 96 - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Bio-Rad
pcr plates Pcr Plates, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcr plates/product/Bio-Rad Average 96 stars, based on 1 article reviews
pcr plates - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Bio-Rad
cfx384 thermal Cfx384 Thermal, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cfx384 thermal/product/Bio-Rad Average 96 stars, based on 1 article reviews
cfx384 thermal - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Bio-Rad
hard shell 96 Hard Shell 96, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hard shell 96/product/Bio-Rad Average 96 stars, based on 1 article reviews
hard shell 96 - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Bio-Rad
quantitative pcr Quantitative Pcr, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/quantitative pcr/product/Bio-Rad Average 96 stars, based on 1 article reviews
quantitative pcr - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Bio-Rad
actcgtttaatccagcttgacg3 Actcgtttaatccagcttgacg3, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/actcgtttaatccagcttgacg3/product/Bio-Rad Average 96 stars, based on 1 article reviews
actcgtttaatccagcttgacg3 - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Bio-Rad
mineral oil Mineral Oil, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mineral oil/product/Bio-Rad Average 96 stars, based on 1 article reviews
mineral oil - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |